Antivaccine activists are incredibly consistent in two things. First, they are conspiracy theorists par excellence. This first observation should not be surprising given that antivaccine views are strongly grounded in conspiracy theories, particularly what I like to call the central conspiracy theory of the antivaccine movement, namely that “they” (the CDC, big pharma, doctors, etc.) “know” that vaccines cause autism and all the adverse health effects falsely attributed to them by antivaxxers but are covering up the studies and data showing that. I’ve been writing about this aspect of antivaxxers for as long as I’ve been blogging, beginning the Robert F. Kennedy, Jr.’s conspiratorial take on the CDC Simpsonwood conference and more recently with Del Bigtree’s cherry-picking of quotes from the World Health Organization Vaccine Safety Summit a couple of months ago. Second, to antivaxxers, it’s always, always, always the vaccines. A recent example occurred when antivaxxers tried to blame the vaccine strain of measles for the deadly measles outbreak in Samoa late last year. Now, with the recent outbreak of serious coronavirus disease that started in Wuhan, China, antivaxxers are looking for another way to blame vaccines. [Note added March 23: the coronavirus is now named SARS-CoV-2, for “SARS coronavirus-2, and the disease it causes COVID-19, for “coronavirus disease 2019.”) Yesterday, they blamed the flu vaccine and viral interference. Today, former scientist turned antivaccine “scientist” James Lyons-Weiler is claiming that 2019-nCoV, the coronavirus strain behind the outbreak, is in reality the result of an attempt to make a vaccine that went wrong.
Because, of course, it’s always vaccines. Always. At least he could have been a bit more original, but originality is foreign to antivaxxers. Their conspiracy theories always involve harm caused by vaccines; so whenever there is an outbreak of a new disease you can always count on them somehow finding a way to blame vaccines, be they existing vaccines like the influenza vaccine or experimental vaccines, like the supposed coronavirus vaccine.
Conspiracy theorists generally don’t want to be perceived as conspiracy theorists; so they often go to great lengths to convince you that their conspiracy theory is reasonable. One strategy they employ to achieve that is to consider, seemingly very carefully, alternate explanations for the phenomenon being “explained” by their conspiracy theory. Lyons-Weiler does exactly that in his post, examining four different “explanations” for the 2019-nCoV coronavirus outbreak:
- Natural coronavirus related to bat coronaviruses, Not a recombined virus.
- A recombined virus that naturally picked up a SARS-like spike protein in it N-terminus (3′ end) of the viral genome.
- A recombined virus made in a laboratory for the purpose of creating a bioweapon.
- A recombined virus made in a laboratory for the purpose of creating a vaccine.
Like any good conspiracy theorist, he examines each “hypothesis” in turn and then—surprise! surprise!—concludes that his hypothesis conspiracy theory is the most likely to be true. Let’s start with #1 (Natural coronavirus related to bat coronaviruses, Not a Recombined Virus.) Lyons-Weiler begins by citing a Lancet paper hot off the presses yesterday on the nucleotide sequence of the 2019-nCoV coronavirus. In it, the authors reported the results of next generation sequencing of samples from bronchoalveolar lavage fluid and cultured isolates from nine inpatients, eight of whom had visited the Huanan seafood market in Wuhan, obtaining complete and partial 2019-nCoV sequences. They then did phylogenetic analysis, comparing the 2019-nCoV sequence to those of other coronaviruses in order to examine the evolutionary history of the virus and try to infer its likely origin.
Their findings:
The ten genome sequences of 2019-nCoV obtained from the nine patients were extremely similar, exhibiting more than 99·98% sequence identity. Notably, 2019-nCoV was closely related (with 88% identity) to two bat-derived severe acute respiratory syndrome (SARS)-like coronaviruses, bat-SL-CoVZC45 and bat-SL-CoVZXC21, collected in 2018 in Zhoushan, eastern China, but were more distant from SARS-CoV (about 79%) and MERS-CoV (about 50%). Phylogenetic analysis revealed that 2019-nCoV fell within the subgenus Sarbecovirus of the genus Betacoronavirus, with a relatively long branch length to its closest relatives bat-SL-CoVZC45 and bat-SL-CoVZXC21, and was genetically distinct from SARS-CoV. Notably, homology modelling revealed that 2019-nCoV had a similar receptor-binding domain structure to that of SARS-CoV, despite amino acid variation at some key residues.
And conclusions:
2019-nCoV is sufficiently divergent from SARS-CoV to be considered a new human-infecting betacoronavirus. Although our phylogenetic analysis suggests that bats might be the original host of this virus, an animal sold at the seafood market in Wuhan might represent an intermediate host facilitating the emergence of the virus in humans. Importantly, structural analysis suggests that 2019-nCoV might be able to bind to the angiotensin-converting enzyme 2 receptor in humans. The future evolution, adaptation, and spread of this virus warrant urgent investigation.
Translation: This virus probably originated in bats, but investigators can’t rule out its going through an intermediary, such as an animal sold at the seafood market in Wuhan where the outbreak originated and a number of non-aquatic animals such as birds and rabbits were also on sale before the outbreak. The authors noted that the genome “sequences of 2019-nCoV sampled from nine patients who were among the early cases of this severe infection are almost genetically identical, which suggests very recent emergence of this virus in humans and that the outbreak was detected relatively rapidly.”
So there is an inserted sequence that is different from the bat strains examined. Lyons-Weiler beliefs it came from a DNA vector pShuttle-SN, that was used in China in the 1980s to create a more immunogenic coronavirus. Let’s just say that he doesn’t make his case very well, but let’s take a look. First, he dismisses explanation #1 thusly:
Option 1. Natural coronavirus related to bat coronaviruses, Not a Recombined Virus.
Evidence for: Phylogenetic clustering with Bat coronaviruses.
Evidence against: Low bootstrap support (N=75) and presence of a INS1378.
Status: Falsified hypothesis. Test: Survey coronviruses in animals in the wild.
Lyons-Weiler might be correct here in that there probably to be some sort of evolutionary or recombination event resulting in the seemingly inserted sequence, but I wouldn’t call the hypothesis “falsified.” He’s leaping to that conclusion because he wants to blame a vaccine.
Next up:
Option 2. A recombined virus that naturally picked up a SARS-like spike protein in it N-terminus (3′ end) of the viral genome.
Evidence for: The INS1378 codon bias similar to snakes ($)
Evidence against: Insufficient match in database search to other known CoV spike proteins (Ji et al., 2020)
Status: Speculative hypothesis. Unlikely.
Test: Find an isolate that matches 2019-nCoV in the wild and reproducibly independently isolate the virus from a wild animal (a match will confirm).
What is “codon bias”? First, let’s explain what a codon is. A codon is the three nucleotide sequence that specifies a single amino acid in the protein that is encoded by a given gene. Because there are more three nucleotide combinations than there are amino acids (64 different codons—61 if you remove the stop codons that tell the ribosomes to stop making protein—versus only 20 amino acids used to make proteins), the genetic code is said to be “degenerate,” meaning that multiple codon sequences can encode a single amino acid, as this chart shows:
Note that “U” is uracil, which is what RNA uses instead of “T” or thymidine, which is what DNA uses. Basically, in terms of the genetic code, functionally U = T. Codon usage bias is a term that refers to a bias in which codons are used to specify a given amino acid. When multiple codons can encode a given amino acid in a protein, organisms have a bias in which codon(s) are used to encode that amino acid. In other words, the codons used to specify a given amino acid are not used randomly. Some are used more frequently than others, hence the term “codon bias” or “codon usage bias.”
What Lyons-Weiler is referring to is this paper, which claims that there was a coding bias consistent with snakes. Lyons-Weiler is also correct that this particular paper is not very good and makes an extrapolation that’s difficult to justify.
As noted in this WIRED story:
“It’s complete garbage,” says Edward Holmes, a zoologist at the University of Sydney’s Institute for Infectious Diseases and Biosecurity, who specializes in emerging RNA viruses, a class that includes coronaviruses like 2019-nCoV. Holmes, who also holds appointments at the Chinese CDC and Fudan University in Shanghai, is among a number of scientists who are pointing out—in virology forums, science Slacks, and on Twitter—what they deem to be major flaws in the paper, and calling on the journal to have it retracted. “It’s great that viral sequence data is getting shared openly in real time,” says Holmes. “The downside is then you get people using that data to make conclusions they really shouldn’t. The result is just a really unhelpful distraction that smacks of opportunism.”
And:
But Holmes says that this approach has a number of issues. For one thing, comparing codon bias is a very indirect way of identifying an animal host. For another, it works best when looking at species from wildly different corners of the taxonomical hierarchy. Plant and mammal viruses have really distinct codon patterns. So do insect and bird viruses. But within more closely related groups, it’s much harder to tease apart meaningful patterns—especially when the authors only sampled a few species. “There could easily be other species out there that are more similar than snakes, but we don’t know because they just haven’t been put in the analysis,” says Holmes. He and others are also skeptical that snakes could be the intermediate host, because there aren’t any documented cases of reptiles hosting coronaviruses that can transmit to humans. Their cold-blooded biology is just too different. 2019-nCoV, and its closest relative, SARS, belong to a subgroup known as beta-coronaviruses, which are only known to infect mammals.
Here’s the trick, though. Lyons-Weiler dismisses the possibility that 2019-nCoV somehow picked up a SARS-like sequence naturally based on a paper that made unjustified extrapolations and assumptions, presenting that paper as though it’s the only evidence for this. In fact, he hasn’t ruled out a recombination event with another, unknown coronavirus. As he himself pointed out, RNA viruses mutate rather rapidly.
Regarding option #3 (that 2019-nCoV was a bioweapon), the less said, the better. There is a BSL-4 (highest biosafety level) lab 20 miles from the Wuhan market, and, of course, whenever there’s a new outbreak one of the standard conspiracy theories that always—and I do mean always—crops up is that the organism causing the outbreak is a bioweapon that got loose. Personally, the version of this conspiracy theory that most amuses me is that 2019-nCoV is a weaponized coronavirus made in Canada and stolen by Chinese agents. Canada? Making bioweapons? Seriously?
Of course, the main reason Lyons-Weiler rejects the bioweapon conspiracy theory is because he wants to push the “vaccine strain” conspiracy theory instead:
IPAK researchers found a sequence similarity between a pShuttle-SN recombination vector sequence and INS1378. Here’s a shot of the alignment and the DOT Plot. Here’s the nucleotide sequence at NCBI’s Nucleotide database. Here’s a patent for its use in recombination virology. The pShuttle-SN vector was among many described in a 1998 paper by Bert Vogelstein et al; here is a company where one can purchase the pShuttle-SN vector.
Before I go any further, I did some BLAST searches for the “INS1378” sequence helpfully provided by Lyons-Weiler. Here is the result.
Not surprisingly, it’s all sequences related to the Wuhan market outbreak, although there is one segment that closely resembles (78% identity) the bat sequence:
I recognized the sort of analysis that Lyons-Weiler had done; so I decided to try to replicate it by aligning the “INS1378” sequence with the pShuttle-SN sequence using the BLAST tool. (Here is the paper in which construction of pShuttle-SN was reported. It was indeed done as the starting point of an attempt to make a vaccine against the SARS coronavirus, using an insert for the SARS coronavirus spike protein cloned into Xho4 and Kpn1 restriction enzyme sites.) My analysis found a sequence 1,182 nucleotides long with 68% identity (which, let me tell you, is not very high). Here’s part of it:
This is pretty good alignment, but certainly nowhere near slam dunk evidence for the origin of 2019-nCoV being the SARS-like spike protein coding sequence inserted into pShuttle-SN, especially when it’s almost certainly more likely that this sequence could have arisen naturally, given how many coronaviruses have SARS-like sequences in them. If this particular sequence in 2019-nCoV actually did come from the vector and the version of the SARS spike protein gene that was inserted into pShuttle to make pShuttle-SN, there should be large swaths of 100% match, if not 100% match.
As an actual expert pointed out on Twitter, the match should be close to 100% for the entire sequence:
I’m starting to think I know why Lyons-Weiler no longer runs a bioinformatics core.
Lyons-Weiler then makes another leap of “logic”:
The very researchers conducting studies on SARS vaccines have cautioned repeatedly against human trials;
“An early concern for application of a SARS-CoV vaccine was the experience with other coronavirus infections which induced enhanced disease and immunopathology in animals when challenged with infectious virus [31], a concern reinforced by the report that animals given an alum adjuvanted SARS vaccine and subsequently challenged with SARS-CoV exhibited an immunopathologic lung reaction reminiscent of that described for respiratory syncytial virus (RSV) in infants and in animal models given RSV vaccine and challenged naturally (infants) or artificially (animals) with RSV [32], [33]. We and others described a similar immunopathologic reaction in mice vaccinated with a SARS-CoV vaccine and subsequently challenged with SARS-CoV [18], [20], [21], [28]. It has been proposed that the nucleocapsid protein of SARS-CoV is the antigen to which the immunopathologic reaction is directed [18], [21]. Thus, concern for proceeding to humans with candidate SARS-CoV vaccines emerged from these various observations.” – Tseng et al.,
The disease progression in of 2019-nCoV is consistent with those seen in animals and humans vaccinated against SARS and then challenged with re-infection. Thus, the hypothesis that 2019-nCoV is an experimental vaccine type must be seriously considered.
This doesn’t even make sense. Yes, in animal models, animals vaccinated with a SARS vaccine then challenged with the SARS coronavirus developed severe disease due to an excessive immune reaction to the virus primed by the vaccine. That is indeed a reason to be very cautious moving to clinical trials of vaccines against SARS, MERS, or 2019-nCoV. It is quite a stretch to think that this observation strongly suggests that 2019-nCoV is likely to have come from a strain made in order to produce a coronavirus vaccine. Even Lyons-Weiler seems to realize this:
The disease progression in of 2019-nCoV is consistent with those seen in animals and humans vaccinated against SARS and then challenged with re-infection. Thus, the hypothesis that 2019-nCoV is an experimental vaccine type must be seriously considered.
Evidence for: Sequence homology between INS1378 to pShuttle Coronavirus vaccine; presence of a SARS-like Spike protein in bat coronavirus, otherwise most similar to bat coronaviruses; low bootstrap value.
Evidence against: Low sequence homology (but highly signifiant). NB these viruses are RNA viruses and they can evolve quickly, even under laboratory conditions.
Status: Most likely.
Test: Determine the nucleotide sequence all laboratory types of coronavirus being studied in China (a match will confirm). Find an isolate that matches 2019-nCoV in the wild and reproducibly independently isolate the virus from a wild animal (a match will falsify).
Seriously. Lyons-Weiler used to do genomics for a living before he turned to pseudoscience. Surely, at some level deep down, he must know what thin gruel this is. In fact, he inadvertently signals that he knows by following up “low sequence homology” with “but highly significant.” Then he concludes that his idea is “most likely” immediately after having dismissed the conspiracy theory that 2019-nCoV is an escaped bioweapon.
None of this stops him from fear mongering about 2019-nCoV:
The implications are clear: if China sensitized their population via a SARS vaccine, and this escaped from a lab, the rest of world has a serious humanitarian urgency to help China, but may not expect as serious an epidemic as might otherwise be expected.
In the worst-case scenario, if the vaccination strain is more highly contagious and lethal, 2019-nCoV could become the worst example of vaccine-derived contagious disease in human history. With an uncharacteristic aysmptomatic prodromal period of 5-7 days, individuals returning from China to other countries must be forthright and cooperative in their now-prescribed 2-week quarantine.
Yes, Lyons-Weiler is actually suggesting that the Chinese sensitized their population with a SARS vaccine and that the vaccine strain of virus escaped from the lab. He soon realizes that that possibility would mean that this outbreak would likely be short and quickly contained, as there is no evidence that China ever conducted a mass vaccination program against SARS. There is, after all, as yet no approved vaccine for SARS. So he has to add that bit about the “worst case scenario” in which 2019-nCoV is more contagious and lethal. The problem is that we already know that it’s definitely not more lethal than MERS (not even close, given that MERS is 34% fatal) and likely not more lethal than SARS. He’s just pulling these speculations out of his nether regions. Whatever the origin of 2019-nCoV, Institut Pasteur has not only isolated and sequenced the responsible strain, but figured out how to grow large amounts of it in culture, paving the way to studies to determine the mechanism for its pathogenicity and to develop an effective vaccine.
James Lyons-Weiler’s speculations and fear mongering just go to show how even a scientist can fall under the spell of antivaccine pseudoscience (or any other conspiracy theory-driven pseudoscience). My guess is that the Lyons-Weiler who once ran a genomics core would have recognized that the “science” that the antivaccine Lyons-Weiler of today is laying down is nothing more than wild speculation that’s based on only the thinnest of scientific gruel and highly unlikely to be true. More’s the pity. Even worse, because he has a background in molecular biology, his conspiracy theory will sound plausible to most lay people.
86 replies on “The latest antivaccine conspiracy theory: The novel coronavirus behind the Wuhan outbreak is due to a failed SARS vaccine”
This is one that most lay advocates would not be able to work through without help of people like you. Thank you.
I’m in a rush, but I saw this morning that the fish market is looking innocent.
Grifters gonna grift, and antivaccine grifters gonna grift the hardest.
I’m waiting for the inevitable Gates-Soros conspiracy to kill off x% of the world’s population.
How was Canada going to distribute this virus? Weaponize their beer?
(Apologies to all Canadians.)
Drat! Didn’t read the previous post before this one. It IS all Bill Gates’ fault, according to some of the tinfoil brigade.
I really have to wonder why this “depopulation conspiracy theory” has the prominence that it does. It does not make one whit of sense. Even if there was some kind of diabolical conspiracy running the planet, depopulation is not in their best interest. Look at what happened the last time that there was such a major depopulation: the Black Death of 1346–1353. Did that do the old elites of the time any good? No! On the contrary, it basically spelled the end for the old feudal order of society. The peasants and serfs wound up with more land, more labour-saving technologies needed to be developed to compensate for the loss of labour force, and the surviving feudal lords needed to kiss up to the surviving peasants else they’d migrate to some other lord who’d give them better terms, and the Catholic Church found itself in deep crisis as its prayers and rituals did nothing to help the plague. Europe after the plague became a very different place, with the power of the old order sharply reduced and the groundwork laid for major political, economic, social, and religious revolutions soon to come.
On the contrary, it seems rather that any such notional secret society of elites running the world with half a brain between themselves would rather want overpopulation instead, the better to divide and rule the teeming masses so they can get cheap labour when they need it, which can’t organise against them in any meaningful way because they’re too busy fighting each other for whatever scraps they can get from the tables of their betters.
@ Anonymous coward
Well, well, well…
https://en.wikipedia.org/wiki/Human_overpopulation#/media/File:World_population_v3.svg
https://www.newsecuritybeat.org/2016/08/water-scarcity-population-growth-trumps-climate-change/
Given the demographic explosion the world is undergoing, an explosion that we do not expect to master sensibly any time soon, and given the water scarcity problem that we are more and more facing, some people worry about a few things. Because water is more precious than gold (or aluminum) for life, people can wage wars over that; And because uncontrolled demographics in the context of water scarcity also triggers population migrations, and hence unrest.
The Middle East is rather worrying when it comes to water scarcity, political instability, population movements and such niceties. Jordan River Basin? Syria, Israel, Palestine, Lebanon, and Jordan needing to cooperate on water issues? Oh well…
Some people I know work in this domain (water management and infrastructure worldwide). And they are very worried. And they do advocate severe control of demographics (though not engineered pandemic…). They’re not that high up in the Illuminati, however… but there really is concern.
Because you’re in a double-bind: if you want to hasten the demographic transition (assuming it’s possible) you have to push places like Africa into economic comfort and political stability as fast as possible (which means important “altruistic” economic assistance, likely with neocolonial whiffs). Which also means higher level of consumption and hence economic development that somewhat is at odds with environmental concerns.
China can master its demographics. Other places are less manageable.
AND you could eat the excess population.
Soylent Greed is Antivaxxers!!!
And another thing about the population control trope is why would Gates and Soros bother, they are not effected by high population numbers and doubt any one in their circle would be either. While i know trying to make sense of these conspiracy nuts is crazy making at times, this one at least is more crazy than most.
On a related note i see the Q Anon conspiracy nuts have also latched on this one – https://www.buzzfeednews.com/article/ryanhatesthis/qanon-supporters-and-anti-vaxxers-are-spreading-a-hoax-that?utm_source=dynamic&utm_campaign=bffbbuzzfeedtech&ref=bffbbuzzfeedtech&fbclid=IwAR0iXMTQFcMENmWsoyqtrc8HrijrrEYPCxb6omYFAqkz2OpatVXFShDncs0
and are telling their cult members to drink bleach as a cure – http://nymag.com/intelligencer/2020/01/qanon-supporters-are-drinking-bleach-to-fend-off-coronavirus.html?utm_medium=s1&utm_campaign=nym&utm_source=fb&fbclid=IwAR0oGI3Ia7GE0zRT16MsZGwrRdRlXwiZKtIZX1XglQ-0w58XCTzLBqE3sdU
the mind boggles
No no Canadians would NEVER weaponize their Beer… it would be their maple syrup – better coverage age wise. (Yes I am joking)
”He doesn’t seem to know what he’s talking about, but he knows just enough to fake it”
A great summary of Lyons-Weiler’s approach to ”Science”.
I have added that to my colloction of quotes. It is so applicable to so many nutters.
Heh. Mike Adams ( Natural News) is already fear mongering about how the Chinese are willing to “sacrifice” cities to the virus to save others.
-btw- he has a history of hate for the PRC. big fan of Taiwan.
It’s a little known fact that Canada did have a chemical weapons program that was pushed out into the USA to allow us to achieve hegemony over North America. Tim Hortons had an additive they were going to put in the coffee and creamers that would cause an insatiable desire for “Beaver Tails” When they were bought out by Wendy’s this of course came to an early end.
Be right back, someones at the door {NO CARRIER}
And a few Indian researches take your supposition that it was just a mutation and shred it. Keep using obfuscation to tote the accepted narrative.
https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1.full.pdf+html
“The finding of 4 unique inserts in the 2019-nCoV, all of which have identity /similarity to amino acid residues in key structural proteins of HIV-1 is unlikely to be fortuitous in nature. This work provides yet unknown insights on 2019-nCoV and sheds light on the evolution and pathogenicity of this virus with important implications for diagnosis of this virus.”
Who is working HIV-1 gp120 with CRIPR? Wuhan Institute of Virology,
https://www.ncbi.nlm.nih.gov/m/pubmed/?term=%22wuhan+institute+of+virology%22+gp120
But you know, keep shilling for a paycheck, I guess.
Oh goody. Another conspiracy theory. You realize that that the first paper you cite is not even peer reviewed, and it’s getting shredded in the comments. For example:
And:
Thanks for the chuckle, though.
I have a better one that is at least slightly plausible. It has been noted below (Dr Peters) and in my Nature feed that the coronavirus is similar to a pangolin virus. Pangolins are used in TCM as well as for food. So…has TCM unleashed this on the population? Another reason to get your medicine from a nice clean bottle and not some microbe-ridden vertebrate!
Wait a minute, just wait a minute. I thought the 1917-18 Spanish Flu Pandemic–according to anti-vaxxers–was the worst experimental vaccine disaster in human history? Now JLW is stomping all over previous anti-vax conspiracy theories and not even clever enough to cite them?
Lyons-Weiler, like all good little conspiracy-mongers needs to feel speshul by “revealing” a nefarious anthropomorphic plot by the NWO. Unfortunately for him, his “hypothesis” is easily refutable. Fortunately for him, his acolytes are too dim to be the ones who could refute his bollocks. The pattern for this epidemic, thus far, does suggest an intermediate mammal host and subsequent mutations within both intermediate and human hosts. Not bioweapon nor vaccine. Oh, does Lyons-Weiler explain how this “vaccine virus” was administered?
And if this is a bio-weapon, its a pretty crap one, the flu has killed more each day just here in Canada (and countless more the world over) than nCoV has during the entire outbreak.
Perhaps they should just re-brand flu each year to make sure everyone gets their shots. Get it on the news that there’s a new mutant virus coming out of [scary foreign place] that will kills tens of thousands, name it after a fizzy drink brand (Coronavirus, Fantavirus, Schweppesvirus, Rwhitesvirus, Pandapop virus, etc) , but they have a shot that will protect 70% of the public. The public will flock to the local pharmacy to get immunized.
The comparison isn’t really apropos; influenza is epidemic year after year. A novel agent with a so far unknown CFR is a different matter. Watch the literature.
He’s got an even dumber follow up piece on nCov19. Bring a barf bag. Included are such silly statements as:
I’m not sure why he thinks a virus with a high mortality in humans has to have a high mortality in humans. Where I live hantavirus from rodents comes to mind. It doesn’t kill them, but it can kill people.
This is an attempt by a hack pseudoscientist to ruin trust in vaccines and public health.
ack….replace “I’m not sure why he thinks a virus with a high mortality in humans has to have a high mortality in humans. ” with “I’m not sure why he thinks a virus with a high mortality in humans has to have a high mortality in animals.”
It is his Dunning-Kruger imperative.
Oh, let’s just keep it simple. It’s a Corona virus, right? Comes from Mexican beer. There. All done!
Also: Goes great with Lyme Disease!
https://www.usatoday.com/story/money/business/2020/01/29/coronavirus-corona-beer-surges-on-google-trends-as-virus-spreads/4606997002/
’nuff said.
N-95, people. It is not just coughing, sneezing, and touching; It is now farting.
I was very surprised to learn that the seemingly low mortality of 2-3% far exceeds the mortality of the flu at .1%. I guess, just a lot more people have the flu right now.
Anyways, about the Drumf(ph) situation. Around my parts, it is all ‘christian conservatives’, ‘evangelicals’.
Well. Core belief boils down to “The father of Jesus Christ raped a minor in her sleep.” And here we are, singing hymes about it.
They have latched onto a demagogue, and nothing trump does is going to sway them. I’ve cleaned up and listened to the 123 minutes of the Lev Parnas recording… At one point, he is trolling Trump by telling him that the letters in his name line up with numeric kaballa (jewish mysticism) script and that it means he is the ‘coming messiah’. Thus, eight days later; Trump declares himself the ‘chosen one — who else is gonna do it?’
namaste
Thanks for cutting to the chase.
Interesting, I was reading the overall plot summary of the 2005 remake of the 1970s series ‘Survivors’ and it used the ‘fatal illness’ caused by GM Cold Vaccine plotline, though that idea of a ‘cure’ producing worse results in the long term goes back much further, the 1990s series ‘Seven Days’ featured a ‘Cancer Cure’ that becomes a virus that decimates the population of the Earth.
Interestingly the title sequence to the 1970s version of ‘Survivors’ implies that the disease that starts everything off was created in a Chinese Bio-Weapon lab and got out by accident.
Something I do not believe happened in this case.
Oh, you sweet summer child.
Well there’s plenty more, here are a trio of 1970s novels inspired by the 1976 Swine Flu Scare:
Vixen 03 (1978) by Clive Cussler makes reference in passing to the 1976 Swine Flu outbreak, saying that the ‘truth’ is locked away in files with a 100 yr plus release date.
Inoculate! (1979) by one Neil Bayne. The novel opens with a lethal flu outbreak at an airforce base in Michigan which rapidly turns into a worldwide epidemic. Investigators then discover that a cabal in the US government created the disease and deliberately spread it in an attempt to create conditions that would allow them to take control of the worlds remaining resource stocks.
The Nightmare Factor (1978) by Thomas N. Scortia & Frank M. Robinson, this one opens with a Legonella style outbreak, but makes frequent references to the ’76 swine flu outbreak. It turns out to be an attempt to create a sterilizing virus, if the victim catches it once, they become sterile. If they catch it again, they die…
And for what it’s worth the title sequence for ‘Survivors’ (1975), which was posted to YouTube in 2014, but has been getting a lot of comments from conspiracy theorists since the outbreak in Wuhan.
@ Graham
Investigators then discover that a cabal in the US government created the disease and deliberately spread it in an attempt to create conditions that would allow them to take control of the worlds remaining resource stocks.
Now wait, that one is believable with John Bolton in the leading roll
I don’t know whether it’s a mixed metaphor, but it does remind me of The Exorcist. (The power of bollocks compels you!)
The antivax cause should have nothing to fear anymore from the CDC. Since Trump took office the budget has been cut repeatedly and massively, and like most of the rest of Federal agencies, it’s hemorrhaging scientists and experts of all kinds.
Hi, Yesterday a viral genome of pangolins was released. The insert he is mentioning has an 83% similarity with the new genomes showing a possible recombination event with pangolins. I did the blast myself. I think that conclusively shuts down the insert conspiracy theory. Novel recombination event seems most likely.
http://virological.org/t/ncov-2019-spike-protein-receptor-binding-domain-shares-high-amino-acid-identity-with-a-coronavirus-recovered-from-a-pangolin-viral-metagenomic-dataset/362
From a Chicago Tribune editorial about the coronavirus outbreak and fake news:
“…some of the people who share bad information do so unwittingly and truly intend to be helpful. But those who make up stories or peddle obvious untruths amid a public health crisis for their own sick purpose or to make a buck deserve a special place in hell. Scaring people with false information or soothing them with fake remedies puts them in real danger…Just look at the harm done by people sharing false information about the risks of childhood vaccinations. Parents shied away from immunizing their kids, and measles — a deadly disease once declared eradicated — roared back to life.
…Clearly, the risk posed by the coronavirus is real. And there is no vaccine for it yet, though researchers are working to develop one. That means the best defense in the early stages of the outbreak is solid, trustworthy, science-based information. Kudos to the journalists, public health officials and social media platforms that are working to disinfect the false outbreak memes and inoculate the information channels with authentic and helpful information from actual health professionals.”
I think the following… “Far more likely, it would result in a coronavirus that couldn’t infect anything because one of its key proteins would be truncated due to a random stop codon.” … is somewhat unconvincing.
Evolution through natural selection results in individuals which are more fit for their environments and not less fit. No population evolves into a population that can’t reproduce since, obviously, the individuals incapable of reproduction have no progeny.
LW points out the viruses are “RNA viruses and can evolve rapidly, even in lab conditions”. He obviously needed to spell out more carefully what he meant here.
Assume for the sake of argument that a virus had been engineered from a bat Coronavirus using pShuttle to insert a sequence from SARS or whatever for some experimental purpose.
The initial engineered sequence will consist of a part identical to the original Coronavirus sequence which has undergone many generations of evolution already and so occupies some kind of local minima in its evolutionary search space and is therefore relatively stable.
The newly inserted sequence on the other hand (aside from the natural subsequence part which might also be relatively stable) has never been subjected to evolutionary pressure and so is far from a local minima in the evolutionary search space.
If the virus starts to replicate in a host, it’s to be expected that the original Coronavirus sequence would remain relatively unchanged but the inserted sequence would evolve rapidly to reach a local minima in the evolutionary search space which optimized the production of the virus in the host.
You’d expect changes which either:
A) shortened the sequence, since this would result in faster replication which would allow shorter sequences to outcompete longer sequences. These changes can occur very easily since they only require dropping the bits of the sequence which are useless for propagation.
B) altered or added to the sequence to increase efficiency. These changes are less likely since most alterations or additions will make the sequence less effective.
So, starting with the engineered virus containing bat Coronavirus, pShuttle and the inserted SARS (or whatever) sequence, you’d expect to find the version circulating in the host population to contain the virulent bits of all of those sequences with the useless bits dropped out.
This is entirely consistent with the 68% identity and the gaps observed in the pShuttle match: that part of the sequence would be expected to have undergone rapid evolution in the initial host since it was novel and had not previously been subject to evolutionary pressure and the kind of evolutionary changes you would expect to see would be many gaps from drop outs and a few changes for increased efficiency.
I’m just a lay person, but, working in computer science with genetic algorithms, I’ve run many billions of generations of simulated evolution and have observed first-hand the contrast between the stability of parts of genomes which have been evolved already for many generations and the rapid changes that occur in new sequences appended to a genome.
We’re not talking evolution and selective pressures. Lyons-Weiler is claiming that this sequence was inserted to make a more immunogenic virus to use in a vaccine. If a coronavirus is intentionally altered by scientists so that it can’t infect anything because one of its key proteins is truncated, it will not be able to evolve anyway, because evolution requires replication in a host. Second, the “engineered” sequence was not engineered to be like the S protein of coronavirus. Lyons-Weiler just found a random weak match with a sequence of a 20-year-old unaltered commercially available shuttle vector used to insert cDNAs into adenovirus vectors. Finally, as just pointed out earlier in the comments, a viral genome of pangolins was released. The insert Lyons-Weiler is harping on has an 83% similarity with the new genomes showing a possible recombination event with pangolins. A novel recombination even in the wild definitely seems far more likely than Lyons-Weiler’s nonsense.
http://virological.org/t/ncov-2019-spike-protein-receptor-binding-domain-shares-high-amino-acid-identity-with-a-coronavirus-recovered-from-a-pangolin-viral-metagenomic-dataset/362
I’m likely to be wrong given that I’ve a sum total of 4 hours of self-taught education in this subject but it looks to me like the 97% reported commonality between the Pangolin virus sequence and the nCoV-2019 sequence is only for the RBD (S1 Receptor Binding Domain) segment somewhere after the 22000 mark in the sequence whereas the inserted region LW is talking about is somewhere before the 22000 mark therefore making them disjoint regions.
The reconstructed Pangolin virus was “84% complete” which leaves enough space for it to not explain LW’s inserted region.
So it looks to me like the Pangolin virus match and LW’s weak match are disjoint and both present.
Am I wrong?
Hi, Sandeep.
One of the other things I’ve noticed with my experiments with genetic algorithms in computer software is that they can be improved by allowing the genotype to carry around some meta-information which determines the genetic algorithm mutation rate and other genetic algorithm meta-parameters. This allows the GA to co-evolve the solution and the GA meta-parameters to automatically tune the GA as it progresses.
From observation, it seems that the GA will initially run itself with a high mutation rate whilst there are many opportunities for improvement but as the algorithm progresses it will tend to evolve towards stability and a lower mutation rate; presumably because this allows it to more efficiently fine-tune a near optimal solution.
Assuming the weak match in nCoV-2019 is actually from pShuttle, it’s interesting to wonder why it would carry around that remnant. If I had to take a guess, (based on my 4 hours of study 🙂 ), I’d guess that those subsequences (which I think I read somewhere are non-coding) have something to do with increasing the mutation rate; it seems to me this is plausible given that pShuttle is apparently something to do with gene splicing.
Perhaps in a vacuum. I’d be careful about extrapolating too much from an algorithm.
I’ve done a little more study and the pShuttle-SN sequence isn’t entirely synthetic, it has some natural bits in it and, since only a small part of pShuttle-SN is present in the weak-match it could easily be one of the natural bits which could have a natural common ancestor with the weak match found in the “inserted sequence”. So pShuttle-SN could easily be a red herring.
Also, I ran my own search (first I’ve tried) using an open web application and it didn’t come back with a match for pShuttle-SN but did come back with a match showing that the supposed inserted sequence was entirely present (90% match) in an isolate collected from bat faeces in 2014 by the Wuhan lab which was uploaded in the last few days.
So there are reportedly naturally circulating sequences looking a lot like the new virus and the supposed “inserted sequence” is reported to have been found in nature a while back in 2014 in which case it could not have been engineered and inserted as a whole in the recent past.
This doesn’t really provide any answers but it does seem that LW’s idea that that subsequence was engineered as a whole might potentially be completely wrong.
Making further progress on this would involve understanding whether the weak match was due to a natural bit or a synthetic bit and looking at the small differences between the bat virus isolate and the virus in circulation, both of which are beyond my skill level.
You sound like you have just enough information to sound credible to lay readers. Why is it I should dismiss Lyons-Weiler’s assertions and accept yours? You, too, could be just as perverse in your intents as you accuse Lyons-Weiler to be.
I, a lay reader, have no means of distinguishing your credibility from his. I have watched the sparring around the influenza vaccines and the Cochrane Collaboration and am quite clear that the ‘scientific community’ is more than willing to pervert its data and spin its results for pecuniary rewards…indeed, Dr. Richard Horton, managing editor of The Lancet, has pointed out that the vast store of data generated for and published by those vaunted “peer-reviewed journals” are, according to him, half garbage. So…Your smug superiority is vastly misplaced.
“Smug superiority”? Sounds like you’d already made up your mind whom to believe before you posted based on what I infer from your comments about Dr. Horton to indicate at least openness to antivaccine pseudoscience.
The post sets out in detail Orac’s substantive criticisms of Lyons-Weiler’s claims. You can read them.
If you are saying “I am not enough of an expert to assess competing scientific claims and conclude who is right,” which is possible and reasonable, than maybe your best bet is to follow the expert consensus.
Which is not with Lyons-Weiler.
Because I have found ‘expert consensus’ to be badly biased. I’ve seen what ‘expert consensus’ has done regarding Dr. Tom Jefferson’s analysis of the quackery of ‘flu vaccines’. I am NOT impressed at all, because that ‘expert consensus’ was protecting the bottom line of the producers of vaccines, not the lives of the potential victims. I have even gotten so cynical that I dismiss, out of hand, all commentators who utilize the term ‘anti-vaxxer’, like the anonymous asshole who wrote this screed, who is probably an industry KOL, hiding behind anonymity to protect the producer fuckwits.
I have not decided yet what I think of Lyons-Weiler’s analysis, but I wouldn’t trust the line of arrogant shit I’ve seen here. Citing Horton’s commentary on the sad situation with the supporting research in the biomedical sciences is cause for suspicion, eh? Why am I not surprised? It is the Semmelweis Effect all over again….that ‘expert consensus’.
So you admit you lack expertise to analyze medical studies, but are convinced you know enough to determine flu vaccines are “quackery.” No agenda there….
Mirrors, honey, mirrors.
Yet here you are defending Lyons-Weiler and calling Orac smug when you don’t even know what either of them are talking about. Tells me all I need to know.
re this ” anonymous” post ?
Orac is not anonymous IF you can read.
Note to newbies:
this functions as an intelligence / reading comprehension/ research skills test of sorts. If you read RI and still don’t know who Orac is., well, you fail because he tells you
I won’t give any more hints
First, let’s get the full quote:
“The case against science is straightforward: much of the scientific literature, perhaps half, may simply be untrue. Afflicted by studies with small sample sizes, tiny effects, invalid exploratory analyses, and flagrant conflicts of interest, together with an obsession for pursuing fashionable trends of dubious importance, science has taken a turn towards darkness.”
Horton seems to have more than a little bit of “smug superiority” going on himself — the biomedical literature is not “the scientific literature” (e.g., I’m pretty sure condensed matter is in the pink). Indeed, lacking data (at least this fellow tried), the best Horton really has to offer is the opinion that half of the stuff published under his watch was badly flawed in one way or another.
Horton did sign off on Macchiarini, Wakefield, and that dire ME/CFS paper, and claimed that all three were vindicated by the facts, before ultimately and reluctantly retracting the first two.
So he does have some experience in the amount of sensationatist fraud published in the Lancet.
I will concede that HEP theory is eminently guilty of “pursuing fashionable trends of dubious importance.”
You sound like you have just enough information to sound credible to lay readers…. I, a lay reader, have no means of distinguishing your credibility from his.
Kelly is arguing that you have enough information to sound credible to a lay reader such as him/herself. Kelly therefore extrapolates to the conclusion that you can’t possibly have more information than that.
IOW you will never be able to convince Kelly, no matter how much evidence you present, because Kelly assumes that any display of expertise above his/her own level of competence is made up.
LOL. Sorry…I’m convinced by Cochrane. This has none of the reputation of Cochrane. This is just asshats like you blovating to your clueless cultists about how you know better than everybody else. Dreck of the worst sort.
“I, a lay reader, have no means of distinguishing your credibility from his. ”
So your internets do not have access to teh googles? Pity, now you just cannot find out the worst secret on teh internets.
But of course you are perfectly happy to accept “information” that’s payed for by Big Alternative, a billion dollar industry?
Yeah? And how is it you determine that? And, why should I be any more happy to accept ‘information’ that is paid for, or generated by, PhRMA, a multi-billion dollar industry which dwarfs ‘Big Alternative’ and purchases and manipulates elected officials and bureaucrats like trained pets just to maintain their bottom line and keep their investors’ ROI healthy?
I thought the whole point of the research in this area was that the virus was live, not intentionally altered to not infect anything.
Does the Pangolin match overlap with the weak match for pShuttle and provide a more likely explanation for that region or are they distinct within the region inserted in the bat Coronavirus sequence? Are they both present?
@ Extended Vacation,
http://recombinomics.co/forum/431-coronavirus-2019-ncov/
I spent another day on this. tl;dr: nothing to see here, move on.
There is an alignment with pShutttle-SN for both the circulating virus and the bat faeces virus but it is almost entirely within the S spike region. Furthermore, the S spike in pShuttle-SN is truncated and there is a SARS S spike which is a much better match for both. So the vast majority of the pShuttle-SN match is explained by a natural common ancestor with the SARS S spike. There is a very small section which matches prior to the S spike (somewhere around 21517). I did another search for this “AGAGTTGTTATTTCTAGTGATGTTCTTGTTAACA” and I think it’s part of Replicase 1B — another natural match.
I then took a look at the receptor binding domain which according to the paper “Isolation and characterization of a bat SARS-like coronavirus
that uses the ACE2 receptor” has five “key amino acids residues involved in interacting with human ACE2 molecule”. I guessed that if you wanted to engineer the virus to be more SARS like you’d want to change these to be identical to the ones in SARS. The SARS five are YLNTY. The circulating virus has LFQNY and the bat isolate has LLYDH. I’m not sure if the framing is right in my analysis here but nothing looks suspicious to me.
I also googled “CTCCTCGGCGGG” which is a small insert difference and found a short article by Bill Gallaher which indicates this doesn’t look engineered either.
I’n my earlier posts I had misremembered the meta-data of the bat isolate. It’s the same one collected in 2013 that other people are reporting, not from 2014 as I wrote previously.
Notes are below if you want to check them. You will need to copy and paste into a monospace font to get the VVVs to point to the five key amino acids.
Wuhan:
399 7e-113 987/1484 (67%) 104/1484 (7%) 21517-22968 945-2356 ENA|AY862402|AY862402.1 Expression vector pShuttle-SN, complete sequence.
396 2e-112 882/1314 (67%) 71/1314 (5%) 21665-22968 115-1367 ENA|AAW56614|AAW56614.1 Expression vector pShuttle-SN truncated SARS coronavirus spike glycoprotein S1 subunit.
2381 0 2783/3735 (75%) 96/3735 (3%) 21665-25384 115-3768 ENA|ABD72978|ABD72978.1 Severe acute respiratory syndrome-related coronavirus spike glycoprotein.
Bat isolate:
435 1e-123 1062/1591 (67%) 86/1591 (5%) 21498-23067 944-2469 ENA|AY862402|AY862402.1 Expression vector pShuttle-SN, complete sequence.
419 2e-119 956/1429 (67%) 71/1429 (5%) 21647-23067 115-1480 ENA|AAW56614|AAW56614.1 Expression vector pShuttle-SN truncated SARS coronavirus spike glycoprotein S1 subunit.
2349 0 2760/3718 (74%) 74/3718 (2%) 21647-25354 115-3768 ENA|ABD72978|ABD72978.1 Severe acute respiratory syndrome-related coronavirus spike glycoprotein.
SARS: YLNTY
Virus: LFQNY
VVV
Query 1314 TAAATATAGGTATCTTAGACATGGCAAGCTTAGGCCCTTTGAGAGAGACATATCTAATGT 1373
||||| | |||| | || || | || ||||||||||| || || | ||
Sbjct 22915 CCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGA 22974
VVV
Query 1374 GC-CTTTCTCCCCTGATGGCAAACCTTGCACCCCACCT—GCTCTTAATTGTTATTGGC 1429
|| || || | | ||| |||||| | || | |||||||||| | |
Sbjct 22975 AATCTATCAGGCCGG-TAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTC 23033
VVV VVV VVV
Query 1430 CATTA-AATGATTATGGTTTTTACACCACTACTGGCATTGGCTACCAACCTTACAGAGTT 1488
| ||| ||| || ||||||| | |||||| ||| |||| |||||||| ||||||||
Sbjct 23034 CTTTACAATCAT-ATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTA 23092
Query 1489 GTAGTACTTTCTTTTGAACTTTTAAATGCACCGGCCACGGTTTGTGGACCAAAATTATCC 1548
||||||||||||||||||||| || ||||||| || || ||||||||||| ||| ||
Sbjct 23093 GTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCT 23152
5’3′ Frame 1
aga ttg ttt agg aag tct aat ctc aaa cct ttt gag aga gat att tca act gaa atc tat
R L* F R K S N L K P F E R D I S T E I Y
cag gcc ggt agc aca cct tgt aat ggt gtt gaa ggt ttt aat tgt tac ttt cct tta caa
Q A G S T P C N G V E G F* N C Y F P L Q*
tca tat ggt ttc caa ccc act aat ggt gtt ggt tac caa
S Y G F Q P T N* G V G Y* Q
5’3′ Frame 2
agat tgt tta gga agt cta atc tca aac ctt ttg aga gag ata ttt caa ctg aaa tct atc
D C L G S L I S N L L R E I F Q L K S I
agg ccg gta gca cac ctt gta atg gtg ttg aag gtt tta att gtt act ttc ctt tac aat
R P V A H L V M V L K V L I V T F L Y N
cat atg gtt tcc aac cca cta atg gtg ttg gtt acc
H M V S N P L M V L V T
5’3′ Frame 3
agatt gtt tag gaa gtc taa tct caa acc ttt tga gag aga tat ttc aac tga aat cta tca
I V – E V – S Q T F – E R Y F N – N L S
ggc cgg tag cac acc ttg taa tgg tgt tga agg ttt taa ttg tta ctt tcc ttt aca atc
G R – H T L – W C – R F – L L L S F T I
ata tgg ttt cca acc cac taa tgg tgt tgg tta cca
I W F P T H – W C W L P
Bat isolate: LLYDH
VVV
Query 1317 ATATAGGTATCTTAGACATGGCAAGCTTAGGCCCTTTGAGAGAGACATATCTAATGTGC 1375
|| | ||||| | | || |||| ||||||||||| || || || | ||
Sbjct 22900 TTACCGTCTCTTTAGAAAAGCTAATCTTAAACCCTTTGAGAGGGATATCTCAACTGAAA 22958
VVV
Query 1376 CTTTCTCCCCTGATGGCAAACCTTGCACC—CCACCTGCTCTTAATTGTTATTGGCCAT 1432
|| | | | |||||||||| | | | ||| ||| ||||| || | |||
Sbjct 22959 TTTACCAAGCAGGCAGCAAACCTTGTAATGGTCAAACTGGTCTAAATTGCTACTACCCAC 23018
VVV VVV VVV
Query 1433 TAAATGATTATGGTTTTTACACCACTACTGGCATTGGCTACCAACCTTACAGAGTTGTAG 1492
| || ||||| |||||| | ||| ||| |||| |||||||||| || || ||||
Sbjct 23019 TTTATAGATATGGATTTTACCCTACTGATGGTGTTGGTCACCAACCTTATAGGGTAGTAG 23078
5’3′ Frame 1
cgt ctc ttt aga aaa gct aat ctt aaa ccc ttt gag agg gat atc tca act gaa att tac
R L* F R K A N L K P F E R D I S T E I Y
caa gca ggc agc aaa cct tgt aat ggt caa act ggt cta aat tgc tac tac cca ctt tat
Q A G S K P C N G Q T G L* N C Y Y P L Y*
aga tat gga ttt tac cct act gat ggt gtt ggt cac caa
R Y G F Y P T D* G V G H* Q
5’3′ Frame 2
cgtc tct tta gaa aag cta atc tta aac cct ttg aga ggg ata tct caa ctg aaa ttt acc
V S L E K L I L N P L R G I S Q L K F T
aag cag gca gca aac ctt gta atg gtc aaa ctg gtc taa att gct act acc cac ttt ata
K Q A A N L V M V K L V – I A T T H F I
gat atg gat ttt acc cta ctg atg gtg ttg gtc acc
D M D F T L L M V L V T
5’3′ Frame 3
cgtct ctt tag aaa agc taa tct taa acc ctt tga gag gga tat ctc aac tga aat tta cca
S L – K S – S – T L – E G Y L N – N L P
agc agg cag caa acc ttg taa tgg tca aac tgg tct aaa ttg cta cta ccc act tta tag
S R Q Q T L – W S N W S K L L L P T L –
ata tgg att tta ccc tac tga tgg tgt tgg tca cca
I W I L P Y – W C W S P
In other anti-vax news…
— AoA ( today) features a video with children imploring us to NOT discriminate against them because of their race, creed, gender, disability or religious views including vaccination status
they ALL deserve an education!
It seems that both Massachusetts and Connecticut may soon have new laws that could limit school attendance to vaccinated students; NY will increase vaccines required and NJ will take up the religious exemption again.
— HBO’s Curb Your Enthusiasm last episode was directed by Cheryl Hines, who is married to RFK jr:: while he was not shown, his “artwork” ( for a fictional charity auction) was and very clearly labelled. Will this sarcastic show somehow work anti-vax into its long list of bizarre issues, crank ideas and frankly awful characters? Lately, they’re been focusing on “Me Too” as the star has been accused ( mistakenly) a few times. He’s inept and cantankerous but not an abuser.
Had someone try the “my child is legally entitled to a public education” argument, but, really, almost every state I know offers some type of online schooling through the public school system, and it seems like a fair option, as I don’t trust any parent THAT committed to not vaxxing with their child’s education. But of course, anti vaxxers aren’t satisfied by anything short of the right to spread disease willy-nilly.
Always an opportunity to bring up San Antonio Independent School District v. Rodriguez: “Since when?” and “Thanks to whom?” (undocumented immigrants; Plyler v. Doe).
Leave it to those exploitive, brainwashing “warrior mommies” to use their children to co-opt discrimination.
Oh I know!
And is the “discrimination” against a student OR their parent’s crazy ideas?
And not allowing children to attend school because of their vaccination status is EXACTLY like barring black students, LGBTQ+ students, disabled students, non-Christian/ atheist students ?
SRSLY. Those kids don’t spread VPDs. Unvaccinated ones COULD. Public Health reasons.
Again, these warrior moms need – in addition to studying life science- history classes. About racism, feminism, gay rights, rights of the disabled, etc etc.
You don’t get special consideration because your parents know nothing. ( Although their can kids suffer)
Which is why multiple courts in California and New York rejected the equal protection – and other – arguments opponents brought against strong school mandates in the past few years.
I have a fever & it’s not the flu, Ha sorry. It’s cold & snowy out & I make little comfort shelters for lost & stray fur babies & set them outside when it gets really bad. My city has one of the largest wildlife urban interfaces in the country & it’s very dangerous here for small animals.
I came in after dark from the snow just sick. There is strep going around. But anyway. I waited all darn weekend for you hens to stop yammering about antivax moms & start discussing Coronavirus but alas; you haven’t.
Random article. Not totally surprised because those Pirbright Coronavirus strains can be administered in drinking water.
https://www.japantimes.co.jp/news/2020/02/02/asia-pacific/science-health-asia-pacific/coronavirus-feces-risk-of-spread/?fbclid=IwAR1Ma5JzyV3SKBnHhXwhcjRLYMHlGVs1Qk27bOI32x63rOlSTp4zzHUTSV8#.Xjjnr47YrnH
But honestly I had been thinking about Joel a lot & how he thinks I am so stupid for believing that adverse reactions to vaccines involve:
"The Genes Loaded The Gun But The Vaccines Pulled The Trigger."
Yes this is SO amusingly idiotic to many here because:
"Why would the vaccines invoke a more adverse event than the pathogen"?
And while there actually are a lot of valid theories for that, I just sort of realized …
"Who gives a flying f***! That's not the point."
Obviously the wild pathogens COULD be as bad or worse. But the vaccines, for me; are a certainty. I WILL have a very bad neurological reaction. Possibly fatal. Not only me but anyone who inherits my risk variants.
With the wild pathogens, I have a fighting chance! I … could WIN or maybe … LOSE but that is MY battle to pick. When you put that antigen in a needle & deliver it past my skin or mucous membranes it’s a done deal. I don’t stand a chance.
I am sorry you are so skeered. I am sorry so many grown men think a vaccinated baby will protect them more than an un-vaccinated one & actually WANT them to. How embarrassing for you. I realize now after seeing the buffoon’s in the CDCs response to Coronavirus; that, you may not actually KNOW how to advise a parent to care for an immunocompromised child (unless you sacrifice people to vaccines). You DON’T DO you?
Oh & yeah you guys are the epitome of Nazi propagandists with your claims of who is a “Risk To National Health!”
https://encyclopedia.ushmm.org/content/en/article/defining-the-enemy
“A number of groups were targeted as enemies or outsiders. They included Jews, Roma (Gypsies), homosexuals, and political dissidents. Also targeted were Germans viewed as genetically inferior and harmful to national health, such as people with mental illness and intellectual or physical disabilities.”
The arrogant “science-based” position: ” Propagandists offered more subtle antisemitic language and viewpoints for educated, middle-class Germans offended by crude caricatures. University professors and religious leaders gave antisemitic themes respectability by incorporating them into their lectures and church sermons.”
“A later film of the same name contained notorious antisemitic sequences. These scenes compared Jews to rats that carry contagion, flood the continent, and devour precious resources.”
I bet you won’t be able to see the similarities. Even those of you who are more Jewish than I am (I would have been called a Mischlinge, due to heritage).
You seek to do the same thing as the Nazis did; propagandize to define who would be excluded from the new society and justified measures against the “outsiders” with your weak assertions that you champion Public (National) Health. The Nazis presented “science-based evidence” of their time too. You HAVE forgotten.
Have you gone completely off the rails, finally?
Oh, and humans have been getting cuts, scrapes, and puncture wounds for as long as their has been people….sorry, but our immune system doesn’t care how the antigen gets into the body.
And seriously, get some help. Your mental state appears to be unraveling, quite badly.
Well, my genetic variation ensures that, often, the wild pathogen is much more dangerous than the vaccine, and unlike you, I don’t have to handwave the mechanics. Don’t blame us that you can’t prove your claims and we can.
I will add, it’ not about babies protecting adults. A lot of it is about protecting infants, like the baby who died of whooping cough in Minnesota, a disease that people like you helped become a growing issue. Of course, you’ll never accept responsibility for the consequences of your actions, because you’re selfish and don’t care about other people.
Yes, because vaccinating children to protect them and those around them from potentially deadly diseases is EXACTLY the same as forcing hundreds of thousands of people into a walled-off ghetto, denying them adequate food and hygiene, rounding up a few hundred at a time, stuffing them into cattle cars in numbers that made it nearly impossible to sit or lay down while providing them no food or water and giving them one small bucket for a toilet, using whips and dogs to get those surviving off the train to line up, sending most of them to fake delousing showers that were actually poison gas chambers, burning their bodies to ash, and using that ash to fertilize the cabbages that made up the “bulk” of the inmates’ diets.
Don’t play the Holocaust card with me. I am an autistic bisexual Jewish liberal They wouldn’t have let someone like me live long before the camps were built. I am well aware of what the Nazis did and how they did it. You can’t compare the crap science they used to justify themselves to the science we discuss here. They deliberately sought out the most discredited, the most worthless, ideas to make their prejudice look rational. Werner Heisenberg, the ‘other’ greatest 20th Century physicist, came under suspicion because of all the Jewish scientists he had associated with. He was cleared because Himmler’s mother’s cousin knew his wife and vouched for him. In fact, Himmler held him in such esteem that he wanted Heisenberg to head up his institute that would be devoted to proving Himmler’s belief that the stars were made out of ice. There are plenty of other examples of what science meant to them and how they perverted and exploited it.
If you do suffer a risk of a life-threatening reaction from vaccine ingredients, that does not make vaccines unsafe or unwelcome for most of the other seven billions of humans. I get serious asthma attacks from aspirin. I have anaphylactic reaction to strawberries. So what?
I avoid things that give me trouble. I don’t advocate for banning them.
FWIW, I was looking at some blogs from a year ago and saw that I had mentioned reading the book, The Lilac Girls by Martha Hall Kelley. It’s a work of fiction about some Polish girls who were taken to Ravensbruck and the subject of medical experiments there and Caroline Ferriday (a real person) who tries to help bring justice to them. I have recently finished it and strongly recommend it. It’s based on extensive research in the U.S. and Europe and gives a gritty account of those events from the viewpoint of the victim and the oppressor.
And on the brain damaged front, I also recommend the Audible special production of Find Another Dream by Maysoon Zayid. She was actually brain damaged by a botched childbirth and has CP. It is very funny and tells her story of growing up with CP and her quest to become an actress as well as a stand-up comic. She currently has a recurring role on General Hospital.
You can hear a little bit of the material in her TED talk here:
https://youtu.be/buRLc2eWGPQ
Regrettably, I still haven’t finished watching Life, Animated.
squirrelelite, coincidentally, I have just recently finished “Rescued from the Ashes” by Leokadia Schmidt. It’s a contemporaneous diary of life in, and escape from, the Warsaw Ghetto, and how she and her husband and infant son survived to the liberation.
It’s far from the only book I have read on the Holocaust, anti-Semitism, and Jewish history. I was privileged to have met survivors, including two in my parent’s living room, and at Kibbutz Lochamei haGetaot – the Ghetto Fighters Kibbutz – when many of the founders, who had been in the Ghetto Revolts, were still around.
Not really on topic, but Kirk Douglas (aka “Spartacus”) died today.
I hope you know how to do it properly. If you’re not padding a big Rubbermaid box (with a six-inch hole cut in one of the short ends) with mamesh straw, you’re doing it wrong.
Try virology.ws and TWIV 584; it’s not anybody’s responsibility here to do what you can do yourself with almost no effort, Bitsy.
FTFY.
Christine continues to hold out for some circumstance where a trigger event causes autism in an infant who would otherwise develop normally. But other than infections during pregnancy like rubella and perhaps influenza, there is very little evidence for this.
And her insistence that a vaccine which triggers the same immune system as the actual pathogen would somehow cause autism while the immune response to the pathogen itself would not amounts to “Easter Egg science”. That is, one must look for some extremely rare circumstance where one causes a problem but the other does not.
And recent studies showing a slightly higher risk of autism in completely unvaccinated children makes it very unlikely that there is a significant population that get triggered in that way.
Please explain how a weakened, or even killed pathogen is stronger than an unweakened one. Share one of your plausible theories.
She doesn’t seem to get that there’s no grand conspiracy to reject her hypothesis. It’s simply that “Immune variations are found in a subset of autistic people, therefore that’s what cause the neurological aspects of autism, therefore vaccines cause the immune variations and as such cause autism” is a really unconvincing argument.
Spending time reading articles and comments here highlights to me how ignorant i really am.
I do wonder about vaccines and i completely understand their importance. My dad says everyone should get to see children that have been affected by measles and understand the cost of not being vaccinated. If a new vaccine came out tomorrow for this virus would you take it? or in 18 months as reported? As in the first one available?
One conspiracy model that scares me is that DNA and the other R one (told you im stupid) are completely new types of vaccines and that some companies may have been using the DNA of an autistic person to create the vaccine which in turn will mutate yours so that you will become autistic.. is that in any way possible or is it completely ridiculous? Its a horrible thought to think that people out there would use vaccines to hurt people.
With regards to the bio-weapon idea, i cant even tell if that has been proven here to be false.. has it? Did it originate in bats and also couldnt be a bio-weapon?
What about the origin timeline given now that ties it down to a very specific time frame, is that correct? if its not it brings more distrust of what is happening right now.
I also get the disdain for people that are conspiracy theorists with respect to prophesies and agenda 21 etc… but its very difficult for the lay person to discern whats real nowadays and heinous and nefarious agendas have happened in the past and continue to happen today.
I read a page in a book printed in 1981 that talks about the Wuhan and this very thing and then bio-weapon legislation was passed in 1989 in the USA so this has been in the psyche for some time and i find it odd that this now happens in the Wuhan, i dont find it unreasonable to think that something like this could happen. From my point of view, there are plenty of plausible reasons as to why this would occur at this moment in time. ( for those interested – epdf.pub_dean-r-koontz-the-eyes-of-darkness.pdf )
My brother is hopefully coming home from HK in 2 weeks and im just going about my business as usual but does anyone think that i should keep my young daughter away from him for a couple of weeks? Her mother was recently in hospital with pneumonia and has a low defense to things as she had hodgkins a couple of years ago? im assuming here that the contagious period will only last 2 weeks if he were to get it on the plane home?
Lastly, it seems that forced quarantine with many other infected people is a terrible idea for the individual.. and perhaps a bad idea with respect to managing the disease as it might provide the perfect playground to get worse.. would both of those assumption be correct?
I am sorry if this comment seems naive and silly but if im thinking it, others must too and i think the answers would be of great help and hopefully satisfy the main reason this site was created in the first place.
sorry – with respect to eyes of darkness it was on page 137
[…] Even under the stewardship of a competent President and administration, whenever there’s a pandemic, there is woo. During the SARS pandemic in 2002-2003, I hadn’t yet started blogging and wasn’t paying close attention to such things. I did, however, see the woo in spades during the H1N1 pandemic in 2009-2010. This time around, it’s so much worse. Or, at least, it seems worse. Maybe it’s the way that social media weaponizes bullshit. Certainly, having a bona fide conspiracy theorist as President doesn’t produce an environment conducive to rational thought. Unsurprisingly, conspiracy theories are flowing freely about COVID-19 coronavirus, including the bogus claim that the flu vaccine makes people more susceptible to COVID-19 and, that perennial favorite during every outbreak of a new disease, the conspiracy theory that the new pathogenic organism was the result of a bioweapon or failed vaccine. […]
[…] “luminaries” like RFK Jr., Del Bigtree, James Lyons-Weiler (who, I note, was in on the COVID-19 grift in January), and more, it’ll cost you $69. Free is good enough for me, as I don’t care […]